UofT DLSPH Webmail Portal LIMS
<< back to search

UAMH 6845 — Wilcoxina mikolae var. mikolae


UAMH Number:6845
Species Name: Wilcoxina mikolae var. mikolae
Type:
Synonyms: show more
Taxonomy: FUNGI Ascomycota, Pezizomycetes, Pezizales, Pyronemataceae
Strain History: H. Wilcox (BDG-MISS) -> Egger, K. (A01789) -> UAMH
Substrate: nursery soil
Location: USA Mississippi (GEO: 32.355,-89.399)
Isolator: H. Wilcox (BDG-MISS)
Isolation Date:
Date Received: 1991-06-12
Characters: MOLECULAR SYSTEMATICS E-strain mycorrhizal fungi - Egger, Can. J. Bot. 74:773-779, 1996 // MYCORRHIZAE DNA polymorphisms - Egger et al., Mycol. Res. 95:866-872, 1991 // MYCORRHIZAE E-strain - Egger & Fortin, Can. J. Bot. 68:1482-1488, 1990 // PIGMENT brown (Click for publications citing UAMH 6845)
Compounds:
Cross Reference: BDG-MISSb // DAOM 213618
Collections: Living Strains; Dried Herbarium Material
Pathogenic Potential: Human: no | Animal: no | Plant: no
Biosafety Risk Group: RG1 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide a CFIA Written Authorization for transfer (http://www.inspection.gc.ca/plants/plant-pests-invasive-species/directives/date/d-12-03/eng/1432656209220/1432751554580#app2)&nbsp;prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 417645
NCBI Taxonomy ID: —
GBIF Taxon Key: —
Sequences:

>UAMH06845_U38636_SSU GATCGGCAACGAACACCACCCGATGGAAAGCTAGTCAAACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAGAAATTGGTTATACATTTCATGTATCAACTGTTTGAACCCATTCTGTGTACCTTGCCTGTTGCTTCCATGGAGCCTGACTTTGGTCACTCTTGTGATGTAAATCCCAAGGGAGTCCCCATGGAAGGTCATCAATAAAACTCATGTATCCAATGTCTTCTGTCTGAACTG

Images