<< back to search
IMAGES:
Search Details
add to cart
| Strain Number: | UAMH 6845 |
|---|---|
| Species Name: | Wilcoxina mikolae var. mikolae |
| Type: | |
| Synonyms: | |
| Taxonomy: | FUNGI Ascomycota, Pezizomycetes, Pezizales, Pyronemataceae |
| Strain History: | H. Wilcox (BDG-MISS) -> Egger, K. (A01789) -> UAMH |
| Substrate: | nursery soil | Location: | USA Mississippi (GEO: 32.355,-89.399) |
| Isolator: | H. Wilcox (BDG-MISS) |
| Isolation Date: | |
| Date Received: | 1991-06-12 |
| Characters: | MOLECULAR SYSTEMATICS E-strain mycorrhizal fungi - Egger, Can. J. Bot. 74:773-779, 1996 // MYCORRHIZAE DNA polymorphisms - Egger et al., Mycol. Res. 95:866-872, 1991 // MYCORRHIZAE E-strain - Egger & Fortin, Can. J. Bot. 68:1482-1488, 1990 // PIGMENT brown |
| Compounds: | |
| Cross Reference: | BDG-MISSb // DAOM 213618 |
| Pathogenic Potential: | Human: no | Animal: no | Plant: no |
| Biosafety Risk Group: | RG1 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | Canadian requesters must provide a CFIA Written Authorization for transfer (http://www.inspection.gc.ca/plants/plant-pests-invasive-species/directives/date/d-12-03/eng/1432656209220/1432751554580#app2) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 417645 |
| Sequences: | >UAMH06845_U38636_SSU GATCGGCAACGAACACCACCCGATGGAAAGCTAGTCAAACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAGAAATTGGTTATACATTTCATGTATCAACTGTTTGAACCCATTCTGTGTACCTTGCCTGTTGCTTCCATGGAGCCTGACTTTGGTCACTCTTGTGATGTAAATCCCAAGGGAGTCCCCATGGAAGGTCATCAATAAAACTCATGTATCCAATGTCTTCTGTCTGAACTG |
IMAGES:
