<< back to search

Search Details

add to cart



UAMH Number:6843
Species Name: Wilcoxina mikolae var. mikolae
Type:
Synonyms:
Taxonomy: FUNGI Ascomycota, Pezizomycetes, Pezizales, Pyronemataceae
Strain History: H. Wilcox (BDG-WV) -> Egger, K. (A01787) -> UAMH
Substrate: nursery soil
Location: USA West Virginia (GEO: 38.598,-80.455)
Isolator: H. Wilcox (BDG-WV)
Isolation Date:
Date Received: 1991-06-12
Characters: MOLECULAR SYSTEMATICS E-strain mycorrhizal fungi - Egger, Can. J. Bot. 74:773-779, 1996 // MYCORRHIZAE DNA polymorphisms - Egger et al., Mycol. Res. 95:866-872, 1991 // MYCORRHIZAE E-strain - Egger & Fortin, Can. J. Bot. 68:1482-1488, 1990 // PIGMENT brown
Compounds:
Cross Reference: BDG-WV // DAOM 213616
Pathogenic Potential: Human: no | Animal: no | Plant: no
Biosafety Risk Group: RG1 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide a CFIA Written Authorization for transfer (http://www.inspection.gc.ca/plants/plant-pests-invasive-species/directives/date/d-12-03/eng/1432656209220/1432751554580#app2) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 417645
Sequences:

>UAMH06843_U38637_SSU GATCGGCAACGATCACCACCGGATGGAAAGCTAGTCAAACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAGAAATTGGTTATACATTTCATGTATCAACTGTTTAAACCCATTCTGTGTACCTTGCCTGTTGCTTCCATGGAGCCTGACTTTGGTCACTCTTGTGATGTAAATCCCAAGGGAGTCCCCATGGAAGGTCATCAATAAAACTCATGTATCCAATGTCTTCTGTCTGAACTG


IMAGES:

There are no images in this gallery.