<< back to search

Search Details

add to cart



Strain Number:UAMH 4661
Species Name: Colletotrichum acutatum
Type:
Synonyms: Glomerella acutata
Taxonomy: FUNGI Ascomycota, Sordariomycetes, Glomerellales, Glomerellaceae
Strain History: Maloy, O.T. -> UAMH
Substrate: sprouts and seed of mung bean Paseolus aureus, causing rapid decay of sprouts in sprouting chambers
Location: USA Washington (GEO: 47.751,-120.74)
Isolator: O. Maloy
Isolation Date:
Date Received: 1982-10-18
Characters: MOLECULAR SYSTEMATICS Blast match 100% ITS similarity with Colletotrichum acutatum species complex // MOLECULAR SYSTEMATICS sequencing from other gene regions needed to confirm species identification // PLANT PATHOGEN caused rapid decay of mung bean (Paseolus aureus) sprouts in sprouting chambers - fide O.T. Maloy 1982
Compounds:
Cross Reference:
Pathogenic Potential: Human: no | Animal: no | Plant: yes
Biosafety Risk Group: RG1 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number (see: https://www.canada.ca/en/public-health/services/laboratory-biosafety-biosecurity/licensing-program.html) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 440865
Sequences: >UAMH04661_ITS CATTACTGAGTTACCGCTCTATAACCCTTTGTGAACATACCTAACCGTTGCTTCGGCGGGCAGGGGAAGCCTCTCGCGGGCCTCCCCTCCCGGCGCCGGCCCCCACCACGGGGACGGGGCGCCCGCCGGAGGAAACCAAACTCTATTTACACGACGTCTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCGCCAGCATTCTGGCGAGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGTTTTGGGGCCCCACGGCACACGTGGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTAACGTCTCGCACTGGGATTCGGAGGGACTCTTGCCGTAAAACCCCCAAATTTTTTACAGGTTGACCTCGGATCAGGTA

IMAGES: