Strain Number: | UAMH 10104 |
Species Name: | Capronia sp. |
Type: | |
Synonyms: | Didymotrichiella / Polytrichiella |
Taxonomy: | FUNGI Ascomycota, Eurotiomycetes, Chaetothyriales, Herpotrichiellaceae |
Strain History: | Allen, T.R. (UBCtra 1046) -> UAMH |
Substrate: | ericoid mycorrhizae, Gaultheria shallon (salal) |
---|
Location: | CANADA British Columbia, Vancouver Island, north island (GEO: 49.651,-125.449) |
Isolator: | T.R. Allen |
Isolation Date: | |
Date Received: | 2001-12-07 |
Characters: | CULTURE CONDITIONS very slow growing; better on CER than PDA // MOLECULAR SYSTEMATICS DNA and culture-based detection of ericoid mycorrhizal fungi - Allen TR, Millar T, Berch SM, Berbee ML, New Phytologist 160:255-272, 2003 // MOLECULAR SYSTEMATICS placed within the Herpotrichiellaceae based on partial sequence 5.8S, ITS2, 28S rRNA gene sequences - Berch S, Allen TR, Berbee ML, Plant and Soil 244:55-66, 2002 // MYCORRHIZAE ericoid - Berch S, Allen TR, Berbee ML, Plant and Soil 244:55-66, 2002 |
Compounds: | |
Cross Reference: | |
Pathogenic Potential: | Human: unknown | Animal: no | Plant: no |
Biosafety Risk Group: | RG1 (check the PHAC ePATHogen Risk Group Database for updates) |
Regulatory Requirements: | No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
MycoBank ID: | 815 |
Sequences: | >UAMH10104_AF300734_LSU
CAGTGAGTCATCGAATCTTTGAACGCATATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTATCAACCATCAAGCCTGGCTTGTCGTTGGACTCTTTTTACCGCTGAAATATGTGGTAGGTCCGAAAGATAATGACGGCGTCGTGTTTGACCCTAGATGCAACGAGCTTTTTATAGCACGCATTGAAGTGGTCGACCGACCCGGTCTTTAACCATCATTTTCTAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGC |