<< back to search

Search Details

add to cart



UAMH Number:11274
Species Name: Meliniomyces bicolor
Type:
Synonyms:
Taxonomy: FUNGI Ascomycota, Leotiomycetes, Helotiales, Helotiaceae
Strain History: Grelet, G.A. (E = GT01P1) -> UAMH
Substrate: Piceirhiza bicolorata ectomycorrhizal Pinus sylvestris root tip, in soil core 0-12 cm deep
Location: UNITED KINGDOM Scotland, Aberdeenshire, Aboyne, Glen Tanar semi-natural Scots Pine Forest
Isolator: G.A. Grelet (B1)
Isolation Date: 2006
Date Received: 2010-09-13
Characters: MOLECULAR SYSTEMATICS genome sequence - http://genome.jgi.doe.gov/Melbi2/Melbi2.home.html // MYCORRHIZAE ericoid mycorrhiza - Grelet GA; Johnson D; Paterson E; Anderson IC, Alexander IJ, New Phytologist 182:359-366, 2009 // MYCORRHIZAE Piceirhiza bicolorata ectomycorrhiza of pine - Grelet GA, Johnson D, Vrålstad T, Alexander IJ, Anderson IC, New Phytologist 188:210-222, 2010
Compounds:
Cross Reference: strain E
Pathogenic Potential: Human: no | Animal: no | Plant: yes
Biosafety Risk Group: RG1 (check the PHAC Biosecurity Portal for updates)
Regulatory Requirements: Canadian requesters must provide a CFIA Written Authorization for transfer prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 500246
Sequences: >UAMH11274_FN179335_SSU-LSU CATTAAAGAATCGCCCCGTTTTTTTGAAATGGGTTCTATTCCCAAACCGTGTATACATACCTTTGTTGCTTTGGCAGGCCGCCTTTTAGGCGTTGGCTCCGGCTGACTGCGCCTGCCAGAGGACCCAAACTCGTTTGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAATAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTATAACCACTCAAGCTTCGGCTTGGTCTTGGGGTTCGCGGTCTCGCGTCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCCGGTGGTTGCCTGCCAGAACCCCCCATTTTTTACGGTTGA

IMAGES:

LOCATION: