<< back to search

Search Details

add to cart



UAMH Number:11150
Species Name: Grosmannia clavigera
Type:
Synonyms: Ceratocystis clavigera / Europhium clavigerum / Ophiostoma clavigerum
Taxonomy: FUNGI Ascomycota, Sordariomycetes, Ophiostomatales, Ophiostomataceae
Strain History: S. Lee -> Breuil, C. (KW1407) -> UAMH
Substrate: mountain pine beetle (Dendroctonus ponderosae) gallery in Pinus contorta (Lodgepole pine)
Location: CANADA British Columbia, Kamloops
Isolator: (C) S. Lee
Isolation Date: 2003
Date Received: 2009-11-04
Characters: BIODIVERSITY mountain pine beetle genomics project // MOLECULAR SYSTEMATICS expressed sequence tags from the blue-stain fungus, Grosmannia clavigera, a mountain pine beetle-associated pathogen - DiGuistini S, Ralph SG, Lim YW, Holt R, Jones S, Bohlmann J, Breuil C, FEMS Microbiol Lett 267(2): 151-158, 2007 // MOLECULAR SYSTEMATICS expressed sequence tags from the blue-stain fungus, Grosmannia clavigera, a mountain pine beetle-associated pathogen - Hesse-Orce U, DiGuistini S, Keeling CI, Wang Y, Li M, Henderson H, Docking TR, Liao NY, Robertson G, et al, BMC Genomics. 11:536, 2010 // MOLECULAR SYSTEMATICS genome and transcriptome analyses - DiGuistini AS, Wang Y, Liao NY, Taylor G et al, PNAS 108:2504-2509, 2011 // MOLECULAR SYSTEMATICS genome and transcriptome analyses - Haridas S, Wang Y, Lim L, Massoumi Alamouti S, Jackman S, Docking R, Robertson G, Birol I, Bohlmann J, Breuil C, BMC Genomics 2013, 14:373. // MOLECULAR SYSTEMATICS genome sequence - Diguistini S, Liao NY, Platt D, Robertson G, Seidel M, Chan SK, Docking TR, Birol I, Holt RA, Hirst M, et al, Genome Biol. 10(9):R94, 2009 // MOLECULAR SYSTEMATICS genome sequence - http://genomebiology.com/2009/10/9/R94 // MOLECULAR SYSTEMATICS identification and phylogenetic classification of cytochromes P450 - Lah L, Haridas S, Bohlmann J, Breuil C, Fungal Genet Biol 50:72-81, 2013 // MOLECULAR SYSTEMATICS identification by padlock probes - Tsui CK, Wang B, Khadempour L, Alamouti SM, Bohlmann J, Murray BW, Hamelin RC, J Microbiol Methods. 83(1):26-33, 2010 // MOLECULAR SYSTEMATICS National Center for Biotechnology Information Genome Project 39847 // MOLECULAR SYSTEMATICS target specific PCR primers - Khadempour L, Massoumi Alamouti S, Hamelin R, Bohlmann J, Breuil C, Fungal Biol 114(10):825-833, 2010
Compounds:
Cross Reference: NCBI Taxonomy ID: 655863 // SLKW 1407 [original assig
Pathogenic Potential: Human: no | Animal: no | Plant: yes
Biosafety Risk Group: RG1 (check the PHAC Biosecurity Portal for updates)
Regulatory Requirements: No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 500813
Sequences: >UAMH11150_HQ633079 CAGGAGATGACCATGTCCTGCTTCGAGCCGAACAACCAGATGGTCAAGTGCGACCCCCGCCACGGAAAGTACATGGCCACCTGTCTGCTGTACCGCGGTGATGTCGTGCCGAAGGACGCCCACGCTGCCGTCGCTACGCTCAAGACCAAGCGCACCATCCAGTTTGTCGACTGGTGCCCGACCGGCTTCAAGCTCGGTATCTGCTTCCAGCCGCCCGAGATGGTCCCCAACGGCGACCTGGCCAAGGTCAACCGCGCAGTGTACGTGGATAGCATCTCTTCCCTTTCTCTCCTGTATGTGTATGTTCTAACAAGCCTAGGTGCATGCTTTCCAACACCACTGCGATCGCCGAGGCCTGGTCCGCACTGTCGGCCAAGTTCGACCTCATGTACTCCAAGCGCGCGTTCGTGCACTGGTACGTCGGCGAGGGTATGGAGGAGGGCGAGTTCTCCGAGGCCCGCGAGGACCTGGCTGCGCTCGAGCGCGATTACGAGGAGGTCGCCACGGATTCCCTGGAGGGTGAGGAGGGCACCGAGGCCGAGTACTAGATTCGAGTCTGGCATCGAGCCTTTACCACTACTACAGTGCTTGTAATTGCAGTGAGAGACAGACTGGCTTTATCGAATTCCCCCCTGAACGT >UAMH11150_HQ633149 TCGGGTGGCCACATCACGATTGATGGCATCGACATATCGACCATCGGGCTGAGTGACCTGCGATCGCGCTTGGCCATCATCCCACAGGACCCAACGCTGTTCCGGGGCACAGTTCGGAGCAATCTTGACCCGTTCAACGAGCACACCGATCTGGAGCTCTGGGAGGCACTTCGTCAGGCCGATCTTGTCTCAGACGAAGCGGCGGAGCAGGCAACAGCAGATATCAACGAGCCTGGAAGTGGTGGCGAGACGCGAGACGCGGGGCGCATCCAGCTAGACAGCGTGGTCGAGGAGGACGGCCTGAACTTCTCGCTCGGCCAGCGGCAACTGATGGCTTTGGGCCGTGCGCTGGTGCGCGGAAGTCAGATTATTGTGTGTGACGAGGCGACATCGTCGGTCGACATGGAGACAGACGACAAGATCCAGCAGACGATTGCGTCTGGCTTCCGGGGCAAGACGCTGCTCTGCATTGCCCACCGCCTGCGGACAATCGTGGGGTATGATCGCATCTGTGTGATGGACCAGGGTCGCATTGCTGAATTGGACAGC >UAMH11150_HQ633219 AGGCTGCACGAACAGCATGGCTCTGTCGTTCGTCTTGGCCCGAACGTGCTCTCGTTTTCGGATCCGAAAGCCCTACGAACAATATATGGATTGAATAAGGGGTTTATCAAGGTAGCTTGGCCCTACACAACCAACTATGTTGACACCAACACTGACATGAGTGCAGTCAGAATTTTATGTTGTGCAGCAGTCCGTGGTCAAGGGGCACAGCCTCGCCAGCCTGTTCAGCACTACAGACAATAGCTTCCACGCACAGTTCCGGCGATGTGTTAACTCGGCGTTTGCCATGTCGGCCCTGGTGCAGTACGAACCATTCGTGGACAACACGACCAAACTCTTTCTCAAGCAGACGGAGAAGCTATTTGTTGGCAACCCGGCTGGATGCGACTTCACCCGGTGGCTGCAATTCTATGCATTCGACGTGATCGGAGAGATAACGTACAGCAAGCGGCATGGGTTCATCGAGAAGAACGAAGACATAGAGGGGATTGTCGACTACCTGTCTCGGCTATTTCTCTATGTGGCTCCGGTATGTCTGAACGGTTGAGGGCGGGTTCCCAGAAGCGCAGATGCTGACATCAAAACAGATTGGACAGATACCGTTGCTTGACCGGCTACTGCTGAAGAACCCGATCTATCTGAAGCTGTCGCAGTACGGGCTGATTGACTCGACCTTCCCGGTGGCGCGATTTGCACGGGCACGGATGGCCGAACGGCTGCCAGACATTGTAGAGGGCAGCGGGCCAATTCTGCCGACAAAGACAGAGAAGAAGAAGCCGACGGTGGACTTGCTCTCCAAATTTCTGGCGGCCAAGGAGGCGCGGCCGGAGTTCATGAACGACACGCTGGTGCAGACGATGGCGGTGTCGATGGCATTTGCGGGATCGGAGACGACGGCGATCTCGCTGTCGGCGGTGTTCTACTATCTGCTGCGCAACCCGACAGCACTGCAGCGACTGCGTCAGGAGCTGGACGAGGCGGCACGGAGCGGGCTGTTCAGCGATTACGAGACAGGGCTGGTGACATGGCACGAGAGCCAGAAGCTGCCGTATCTGGACGCATGTGTGAAGGAAGCGTTTCGGCTGCACCCGGCACCGGGGCTGCCGATGGAGCGGGTGGTACCTGCGGGAGGCATGGAGATCGCTGGTCATTTTGTCGCGGGCGGCACCATTGTCGGCTGCTCGGCCTGGGTGATGCACCACAACAAGGCCGTGTTTGGCGAGGACACGGACGCGTACCGGCCGGAGCGCTGGCTCGTGGACGAGGCGGTGGCAAGCAGCAGCGCGGACGCGCGGGTGGGCGAAGAGCAGCGGATCAAGGAGATGAACGGCATGATGCTGCAGTTTGGCATGGGCTCGCGGACATGCATTGGCAAGAACATCAGCCTGTTGGAGATCTACAAGGTGGTGCCGAGCTTGCTGCGGCGGTTTGAGATCCAGTTTCTGGACGAGAAGCTGGAGTGGGAGCTGGTCAATGCCTGGTTCGTGAAGCAGAAGAACTTTTGGATCACGTTGGCGATGCGAGATCTGGTGCAGAAGAGTGAGAACGTGTAA >UAMH11150_HQ633289 TGGTTCAACTATTTGGCTTTTGACGTGATCGGCGACCTGGCTTTTGGTGCGCCCTTTGGTATGCTCTCGAGCGGCGCCGATATTGCCGAGGTGCGGGCCTCGGCCGACAGCCCACCGGTGTACGCGTCCGCGATTGAGATTCTGAACCGGCGCGGCGAGGTCTCGGCGGCGATTGGGATTCTGCCGGCCCTGAAGCCGTGGGCCTCCTGGATGCCGGACCCGTTCTTCCGCAACGGGTCCAAGTCTGTCCAGCAGCTGGCCGGGATTGCTATCGCCCGCGTGCGCGAGCGTCTGGAGCGCCAGCCGTATGGCAAGGACCTCGAGAACGGCCGGAAGGATCTGCTGGCCCGTCTGATGGAGGGCCGCGACGACAACGGCGCCCCGCTCGGCCGCGAGGAGCTCACGGCCGAGGCTCTGACCCAGCTGATCGCCGGCAGCGACACCACCTCCAACTCGTCGTGTGCCCTGCTCTTCCACGTCGTCCGCACCGACGGCGGCCGCGTGCTGCGCCGCCTGCAGGCCGAGCTCGATGCCGCTCTGCCGGCCGGCAAGGACGTGCCCACCTTTGACGACGTCCGCAACCTGCCCTATCTCCAGTCCGTCCTCAACGAGACCCTGCGCCACCACTCCACCTCTGGCATCGGTCTGCCGCGCCAGATCCCCGCCGATAGCGCCGGCATCACCCTGCACGGTCACTACTTCCCGCCCGGC >UAMH11150_HQ633359 TCGTTCTCCGTGTGGTTACCGCGGTGGTGGCGAACGGGCGCGCGCTTCGACTCGGTCGACTGGGCACGCAGGTGCGCCTGGTGGACGCGCGGGTCGATGACGTTTCGTGAGGCTTACGAGCGCACTGGGCGCATCCTCAACGTGACGTGCGTGCCGGCAGACCCGCACTCGCCGACGATCCTGTGCAACTATCGCACCTCGCCCGACTGCGTCATCTGGTCGGCCGTGCTGGCGTCAGCTGCTGTGCCGGGCATCCTCAACCCCGTGGTGCTGATGATGAAGACGCCGGTGCCGGGAGAAGCTGGTGGCAAAAATTACCGGCTGGTGCCGTATTCGTTTGGCCACAAGTGGAAGGATGGCAGTCTGCGGACAGACATCCCGCTCAAGGCGCTTAACCTGCACTTCAACGTCAACTTCACTGTCGTCAGCCAGGTAAACCCGCACGTCAATCTCTTCTTCTTCAGCAGCCGCGGGTCCGTTGGTCAGCCGGTGACTCACCGCAAGGGCCGCGGCTGGCGTGGCGGTTACTTGGGCTCGGCCTCTGAGGAATACTTCAAGCAAGACCTGCGCAAGTGGCTCAAACTGCTGCGTAACTTGGAGTTACTGCCCCGGCCGCTGGGCCAGGACTGGTCGCAGTTGTGGCTGCAGCCCTTCAGCGGCACCGTGACCATCTGGCCCAAGAGCGTGCTCTCCGACTTTGTCCATATCTTGTCCGACCCCAACCCGACCCGGCTGGCTCACATGCTGCACGAGGGCTGTCAGTCCGCCTTCCCACCGCTGAACTTTGTGGCCAATCGCCTGCGTGTCGAGCGTATGGTCGAGCGCGGTCGGCTTGCGTCACGCTTGCACTATGGTAGCGATGGTGGCGTTGGCGGTAGTGGTGATAGTTTCTGGTCCGGCCATCACGCCGGTGGTGGTGGCAACATTGACTCCATAGCCAGCGAAGACGAGTTTCATGTCTTGCTGGCTGGTGAGGGCCCGGCTGCCAGGCGCTTCGGTAGCCGCCGTGGTCGGGCCGGTTTGGGTCTCGCCAGCACGACGGCCACGTCAGACGAAAACATGTCCCTCTCATCATCGTCTTCATCGGACGTTGAAGCTGCAGCAGCTCGACCCAGCGTCGGCGAC >UAMH11150_HQ633429 GTAAGCCCAATGTCTCGCCGCGCTCCGTCGTCCTTCCAACGCTGACTCTGTCGACCCTCTTTTTAGCAAAGCTGCGCCAGCAAGTACCTCGCCGGCGGCATCGGCAACTGCGGCACCGATCCCAAGTGCATCTGCGAAGACTCGGATTTTATCAGCGGCATCGCCTGCTGTCTGGCTGAGCCCGGTGGCTGCGACACGGCCGATCAGTCCTCGGCCGTCGCCTACGCCTCGCAAATCTGCGCCGCCCAGGGCGTCACCGTCCCTTCGGCCGTCAGCTGCACGTCCTCCCTTTCCAGCTCCGGCACCGCTGCTTCGGCTGCTACTGCTACCGCCACCGTCTCCTCCAGCACCGCTGCGACCACCGCCGCCACCGTCGCGTCCACCAGCGCAGCCACCACCGGTGCCAAGACCTCGACCAGCTCGACGGCCAAGTCGGCCAGCTCCACCAAGTCGGCCACTGCCTCGACCGCTTCGGTTGCCACCACCGCGGCCAGCTCGGCCAACTGGGCACCGCAGCAGTCGGCCGCCCTGGGCGGCGTCATCGGCGGTCTCGCCGCCGCTCTAGCCCTGCTGTAAGCTGGTGTGGAGTCTGGAGAGACAGGGCAGCATTAGTTGCGGGGTCAACGGCTATTAGGTCGGCCTTGCCGCTGAACCGTGTGCTGGGACGGTCTGTGG >UAMH11150_HQ633499 TCGCTGAGCTGCTTCCACCAGGCGGCCCAGACCTTTAACTGCGATCCCCATGACATTTCCTGTCGCTGCTCCAAGGAAGTCCAGATGACAGCCACCATGGAACGCTGTCTGCAGCGATCCTGCTCGGACCACCACAAAGCGAGTGCGTGACCCTACTGCTGCCGCCTGCTGCTAATCCATCTGCTGACATAAGCACAATTTCTCAGTCACCGAGAATCTCTCCCACGAGATCTGCAACATCCAGCTGCAGAACAACATGCTGTACAAGAAGTCGGCCGAAGCCGCCCCAGCGCCAGCTCCAGCTCCGGTTCCGGCAATCCCAGATGTCCCGGTCGTGCCGGATTTTGCTCGTCGGGCGCCTGAGGCTGTGGCGTCGTTCCCGGTCATCGCCTCGAGCATCCCGGCATCGTCCATCGCCCCCTTTGCGACCAGCACGGCCACACCGGCGCCCGTCGTGACCGCCGGTGCCGCCGCAGTTGCCACGCCCGTTGCC >UAMH11150_HQ633569 CTGGGACTGGGATGTCTAGACTCCTGACGGTTGTCTGACAATTCGCTGATCTTCTAGGGCATGCGCATGCCGGGATGGTATGACATTGTAGGTTGATCTAGGTCCTGTTGACGTTGACCTCTCCTCCTTCTCTCCCCCCTCTCACATCGCCCAGGTTTCCTTCGACAGCCCGGGCACCAGCCTGCGCGACAACGAGGACGAGGCCGGCCTCGTCGCCTCACGCGCCTACTTCCACCAGCTGGTCCAGCAGGAGATCGATGCCGGTGTGCCGGCCGAACGCATCGTCCTCGGCGGCTTCTCGCAGGGCGGCGCCATGGCCATCTTTGCCGGCATCACGAACCCGCGGCGGCTGGCCGGGATCGTGGCCATGTCCACGTACCTGGTGCTCTCGCAAAAGATCGAGTCGAAGTACCTTCCTAGCCCCAACGCCAACGCCTACACGCCCGTCCTCTGGTGCCACGGCACTGCCGACCCGGTCCTGCCCTACAAGATGGGTGAGCTGTCACGTGACGCCCTGCGCCGCATGGGCTATCCTGTCGAGTGGAAGTCGTATCCCGTGAGTGTGCGCC >UAMH11150_HQ633639 ACTAGCGAGCGCATGCTGACTAATCTGGCGGTCGAGTACGAGCGTCTGGCGGACCCGCGGCTGCCGGCATGCAGCCGCAAGGCCGGCCACCTGCTCGAGACCTGCTGCACGATCATGGACATGAAGGGCGTGGGCATCTCCAAGGCACCGCAGGTGTACGGTTACATCCGCCAGGCCTCGGGCCTGTCGCAGAACTACTATCCCGAGCGCCTGGGCCGCTTCTACCTCATCAACGCGCCCTGGGGCTTCTCGGGCGTCTGGTCCATGATCAAGGGCTGGCTCGACCCCGTCACCGTCGCCAAGATCCACATCCTCGGCAGCAGCTACCAGAAGGAGCTGTTCGAGCAGGTCCCGCCCGAGAACCTGCCCAAGCGCTTCGGCGGCCAGTGCGAGTGCCCCGGCGGCTGCGAGCTCTCCGACATGGGCCCCTGGCACGAGGACGAGTGGTTCCGTCCAGCCAAGTGGGCTCGGGAAGCCACTGCGGCTGCCGACAAGTCGGCAGAGGCTGGTGCCGGTGCTGTGGAGGGCGTCACACTTGAGGTCCCCGGTGATGCCGTCGGCGAGGCCACT >UAMH11150_HQ633709 TTCTATTTGCTGCTGCCACCACAGAAGCTCACAAGCCAGATCTACTTTACCGACGTCATGCCCAAGACAGCCACCGGCAAGATTCAGAGACGGATCGTTGCCGAAACCATGCAGAAGCAGGACGGCAAGGCGAAGTTGTAGAGTGTTGTTGTTGTAAGGATAGAGCTGTATTATCGGAAAGGGACGTGTGGTATGAATATAGTGTTTATGTCAGGGAGAAGCTCGAATCTTATGCAGACGCACAATGTAGACGGGCCTGCTTAGTAAATTATCGTAACGTTTTATAGCCTTGCCGAACAGCCGAATGCGATGAAATCAAACGAACATTAAAACAAGCATCCGTGGGCCGGCCGACCTCCCCCTTGCCTCTAGATAATTTTGTACATGCAGACTCTGTCCACTGTGTCTCTGCCATGAGCCTGTATCCGCTGCCTGCGTCCTCTCCTCATGAATCGCTCTCCCCTAGTTCCTGCTCTCTCTCCTCTCTCTCGCCCCTCGGCTCCCGTCTCAAAAAAGGCAGTGGTCAACGGCGACATGGCGCGAGACAGGGCTGCTGCAGAGCGTGCCGCAGCCGGAAGTCGACGACGCCTCTGCTCTCCGGCGGGCTGCTTCCTAGTAACCCTCGGCGCCCGGCGCTTTCTCGTCCTTGCGCAGGCTGACGAGGAGCTCACGGAAGCGCTCCTTG >UAMH11150_HQ633917 GAGCTCACGTCGCTGATCCAAAAGCGCTTCAAGTTCCCCGAGAACAGCGTGTCCCTGTACGCCGCCAAGGTCCAGAACCGCGGTCTGTCGGCCGTGGCCCAGTGCGAGTCGCTGCGGTACAAGCTGCTGAACGGCCTGGCCGTCCGCCGTGCCTGCTACGGTGTCCTGCGCTTCATCATGGAGAGCGGCGCCAAGGGCTGCGAAGTTGTCGTGTCCGGCAAGCTCCGTGCCGCCCGTGCCAAGTCCATGAAGTTCACCGACGGCTTCATGATCCACTCCGGCCAGCCGGCCAAGGACTTTATCGACAGTGCCACCCGTCACGTGCTGCTGCGCCAGGGTGTTCTGGGCATCAAGGTCAAGATCATGCGCGGCTCCGACCCTGATGGCAAGGCCGGCCCGCAGAAGACCCTGCCGGATGCCGTCACCATCATCGAGCCCAAGGAGGAGCAGCCGGTGACCCAGCCGATCAGCCAGGACTACGGCGCCAAGGCCGCACAGCAGGCCGCTGCCGCCGAGGCCCAGCGCGCCCTCGAGGCCCAGCAGGCCGCAGCCGCAGAGGAGGAGGCCGCGCCCGCTGAGCAATAGGATGCTCGACGTGCAGCTGGTGGCGACGGTGCCGGTCTCTTGGATGGCGCTGGACCTGTCGCTGGGGAGGCGTTGGGTGGAGCAGCGATGATCGGACTCGGGCCTGTCGGAGTCCAGAACGACGGTTACGGCAGACACGAGCGGACGGCTAGTGCC >UAMH11150_HQ633987 TCGCCGCACCACCCCAAGGCGATAGACCCGATCCAGTCAGCGTCCAACGTGGTGCTGATCGACAACTATGACTCGTTCACGTGGAACGTGTACCAGTACCTAGAGCTGGAGGGCGCATCGGTAACGGTGATCCGCAACGACCAGATCACGCTGGAGCAGCTGATTGCAAAGAAGCCGACACAGCTGGTGGTGAGTCCGGGGCCCGGTCACCCGGCGACCGACTCGGGCATCAGCCGGGACGCAATTCGGCACTTTGCAGGCAAGATCCCGGTGCTGGGCGTCTGCATGGGTCAGCAATGTATCTTCGAGGTGTTTGGTGGTACGGTCAGCTCGGCCGGCGAGATTCTGCACGGCAAGACGTCACCGCTGGTCCATGACGGCCGCGGGGTGTATGCGGGGCTGCCACAGTTGCTGCCGGTCACGCGTTACCACTCGCTGGCGGGCACGCGCGGCACGCTGCCGCCATCGCTCGAGGTCACGTCGTGGATCTCCAAGGCTGACGGCAGCCCGGGCGTGATTATGGGCGTGCGTCACAAGGAATATACGGTGGAGGGTGTGCAGTTTCACCCGGAGAGCATTCTGTCGGTGTCGGGCCGTGGCATGTTCCACAACTTTCTGGTGATGCAAGGCGGCACCTGGGCCGAGAACGAGCAGCTGCAAGCAAAAAACACTACAACGGAAGCCATTGCGGCTGCTGCTTCGGCCAAGACCAACATCCTGCAGCAGATCTTCTCGCGTCAGCGCATCGCAGTAGAGGCGCAGAAGAAGGTGCCGTCGCTGCGGCCCGAGGACCTGCAGGCAGCATACGACTTGGGAGCAGCACCGCCAGCACTGTCGTTTGCAGACCGGCTGCGACAGTCGCCATTTCCGGTGTCGCTGATGGCCGAGATCAAGCGGGCATCGCCATCCAAGGGCGTGTTCGCCATGGACATCCGGGCGCTGGGGATGGAGCCGCTGGTCGAGGTGCAGAACGCGGCCGAGATGGAGCGGGCTGTTGGCCAGCTGGGCGCCAAGGTCATCGGCGTCAACAACCGCAATCTCGAGAGCTTCGAGGTCGACCTGAAGACGACCAGTCGGCTGCGCAGCATGGTGCCGGCCGACACCATTCTCTGCGCCCTCAGCGGCATCAACACGCGTGCCGACGTCGAGGCTAACGAGCGCGACGGTGTCAATGCCGTCCTCGTCGGCGAGTCCATCATGCGTGCTGCCGATCCTGCTCTATTCATCCGTCAGCTCTGCTCAGGCTCAGGTGCGCCGGCTCCTTCTTCCTCTTCTCCTGCTGCTGCACATTCCTTACTCGTCAAGATCTGCGGGACGCGTAGTCCCGAGGCTGCCCTCGAGGCTGCCCGCAGCGGTGCCGACATGGTGGGCATAATCTTTGCCCCCGGCCGCAAGCGCACCGTCTCACACGAATCCGCCTTGGCCATCTCGCGTGCTCTGCACGGCTTTGCCGATTCCGACCCGTCCAGCTCTACGGCCACGGCTGCCAAGACCGCCACTGCCACCGTTACTGCCACCGATTTCTTTAGCCTCGCCCGGAAGACACTCGCCCGCCGGAAGCGGCCCCTCCTAGTAGGCGTGTTCCTGGACCAGCCGCTCGAGGAGGTGCTCGAGAAGCAGCGACTGTATGATCTAGACGTCGTCCAGCTGCACGGCCGCGAGCCCATCGAGTGGGCGCGCTGTATCCCGGTGCCGGTGATGCACAAGTTTCAGCCGGGAGAGCCTGGTCTGGGCGTGCGCGGCTACTACACGGCGCCTCTCCTGGACTCGGGCGCAGGGTCGGGCCAACAGCTGGACACGACGGCCGTGCAGGTCGAGCTGGACCGGGACCCCAGATTGGAGTTTATGCTGGCCGGCGGCTTGGACCCGGACAATGTCAGCGAGGCACTAGGCGCATTCGACCGCGACAGCCGGGCGCGGATTATC >UAMH11150_HQ634056 GTGTGTCCAGATGTGCGACTGGTTTAAGGGACTGTGACCCGCACTTGCTTAGTCATGCATAATACCCGGAAATGCTGAATTCCAAAAAGCGCCAGGACTCCAATGCCATCATCACAGTTCACCAGTTCTCCATTGCAATGGCCACGACGGAGACTCTACTAGAGAGCGACGGCTTCGTGCTCGTGTCGCACGCAGATGCGGTCGAGCTGGGCAGCAGAGAGGCCAGAGAGGCCAGGGAGGTATCCGGCCGGTCGGCCTCACCGCCACGGTATCTCGCCGCAATCTCGGCGTGTGTCGACCAGGCCAGCGCGTCTCTGTGGCCGCTCAATCGGCATATCCACGACCACCCGGAGCTGGCCTTTCACGAATTCGAGGCGCACCGACGGCTGACGGCCTTTTACGAAGGGCGCGCCATCGGCAGCGGCAACCACAGCGCACGCTGGACGGTCACGCGAGAGGCCTATGGTATGCGCACAGCTTGGGTGGCCGTCTACGATAGCGGGCGAGCTGGGCCGGTCGTCTCGTTCAACGTCGAGATGGACGCGCTACCCGGCGTCGGCCACGCCTGCGGCCACAACCTGATTGCCACGGCGTCTGTGGCCGGCAGCCTGGCGACAGCCGAGGTGATGTGGCAGCATCGTCTCGGAGGAAAGATTGTCGTCTTTGGAACCCCGGCCGAAGAGGGTGAGTTCTGTTTGTTATCACGCTGTTCCGTTCTTCGTTTCATCGTGCTCGTCATCCCCACTGTCCGTCTCTAGTTCCGTCTCCACCTTTTCGTTTCCACCGTTAGACTCTTCGTTCACCGTTCCGTTCCACCGTTCTGCTCTTCTTCGCTCATCATTCCGTCTCTTGCTTCACCCCCCTGATTCCCCTCCCCTACTCCGTACTGACCCTTCAGATGGCGGTGGCAAGGTCTGCCTCCTCGAAGCCGGCGCCTACCGTGAGCATGGCGCAGACGTGTCGCTCATCACGCACCCAAGCACGACGACGCCCAGCGCCATGATGCGCACGACAGCCATCACCAACTTCATGGCCTCGTACGAGGGCCGGGCAGCCCATGCGGCCGCGTCGCCGTGGCAGGGTGTCAACGCGCTGGACGCTCTCGTGCAGGCGTACACGGGCCTCTCAATGCTGCGACAGCAGACGGCGCCGGGCGACATCATCCAGGGCCGCATCACCGACGGCGGCGCAGCCACCAACATCATCCACGAGCACGCGGCCGGCGAGTTCGCCGTGCGAGCACCCTCGAAGCGTCGCCTCGCTGAGCTGCGCCAAAAGGTTGACGGTTGCTTCCGTGCTGGTGCCGAGGCTACTGGCGCCCGTTTGACGCTTGATGAACGCGGCGGCTACGCCGATCACATCCCCAACCGGCTGCTGGCCTGCGCGTATTCACGTTACTGGAACGAACTCGTGCGCCAGGACCCTGCCGTCCCGGACGACGAGCACATCCCCGACAATCTCGACGTCGACGACGCCCGTGGAAGGACTCTTGCCAGTACCGATCAGGGCGACGTCAGCTACGCGATGCCCAGCCTCAGCGCCGGCTTCCGCATTCCGTCTATCCCCATCGACGGCAGCAGTCGTCCTGGTGGTGGCCCCCACACTGTCGACTTTGAGCGCGCTGCAGGCACGCGCATCGCCTTTGAACATGCCTTGCGTGCTGGCAAGGGC >UAMH11150_AY544597_actin GGTGTTGTCACCAACTGGGACGACATGGAGAAGATTTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCTCCCGAGGAGCACCCCATCCTGCTCACGGAGGCTCCCATCAATCCCAAGTCCAACCGTGAGAAGATGACGCAGATTGTGTTCGAAACCTTCAACGCACCGGCCTTCTACGTCAACATCCAGGCCGTGCTGTCCCTGTACGCATCTGGTCGTACCACTGGTATCGTTTTGGACTCTGGTGATGGTGTCACTCACGTCGTGCCCATTTACGAAGGTTTCGCTCTGCCGCACGCCATTGCACGTGTCGACATGGCTGGCCGTGATTTGACCGACTACCTGATGAAGATCCTGGCCGAGCGCGGTTACTCCTTCTCCACCACTGCCGAGCGCGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTGGACTTTGAGCAGGAGATCCAGACGGCTGCCCAGAGCTCCAGCCTGGAGAAGTCATACGAGCTTCCGGACGGTCAGGTCATCACTATCGGCAACGAGCGGTTCCGCGCCCCCGAGGCTCTGTTCCAGCCGTCCGTGCTGGGCCTGGAGAACGGCGGTATCCACGTGACCACCTTCAACTCGATCATGAAGTGCGATGTCGATGTCCGGAAGGACCTGTACGGCAACATTGTCATGGTAAGTGGCGACAGGCAAGGTGGCGAAACGGGTGACACGCACAACGGAACTTTCGCTGACACTGTCTTTTTTCCCCCATCTCTAGTCTGGTGGCACCACCATGTACCCCGGCCTGTCGGACCGTATGCAGAAGGAGATCACCGCCCTGGCCCCGTCGTCGATG >UAMH11150_AY263195_beta-tubulin ATGCGTACGTTTCGCCCTACTCCGAATCAATCGACCCCTACAGGCCCCCAGGCTCCGACGAAACAAACCTTAAACTGACACGGGCTATGGCATAACAGGGTAACCAGATCGGTGCCGCTTTCTGGTAAGTTTTATCTGAGCTATAAATAACGCATCTGGGCAATCAGCTTGAAGTGACAAATTCTAACCTACTTCACAGGCAGCAGATCTCCAGCGAGCACGGTCTCGACAGCAATGGAGTGTAGGTTTCCGGTTTCGGAAGAGTCTATTGTGGTGTATATCATCTAATATGTTCTATCAGGTACAACGGCACGTCTGAGCTCCAGCTGGAGCGTATGAGCGTGTACTTCAACGAGGCCTCGGGCAACAAGTATGTGCCCCGCGCCGTCCTGGTCGATCTCGAGCCCGGCACAATGGATGCTGTGCGCGCCGGTCCTTTCGGACAGCTCTTCCGGCCTGACAACTTCGTTTTCGGCCAGTCGGGTGCCGGCAACAACTGGGCCAAGGGTCACTACACGGAGGGTGCCGAGCTTGTGGACCAGGTGCTCGACGTCGTCCGCCGCGAGGCTGAGGGCTGTGACAGCCTCCAGGGCTTCCAGATCACGCACTCCCTGGGCGGTGGCACGGGTGCCGGTATGGGCACCCTGCTAATCTCCAAGATCCGCGAGGAGTTCCCCGACCGGATGATGGCCACGTTCTCGGTGATGCCGTCGCCCAAGGTGTCGGACACGGTTGTGGAGCCGTACAACGCGACTCTATCGGTGCACCAGCTGGTGGAGAACT >UAMH11150_AY544638_elongation factor-1 alpha ACTACCGGTCATCTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATCGAGAAGTTCGAGAAGGTTCGTTTTTTCCCTCTTGCTCGCATCTACCCTACCTTACCCTACTGCACACGACACGTCCACTTCCTTTTTCTCATTATCAGAATGTGGGGTTGGAGGGGCAAATCCTCTTCCCTGTCTTTCTGCCTTGTGGACCCTGAAAATTTTTTGGGCGGTCAGGTTCCAAGCACAATCATCTTGGTGCACGGACCACAACCAGATCCAACCCAACCCCATACTCTATTTACGCCATCTCATCCCCACCTGCTTGCATTTAGATTTGCCGCTAACACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGCGGTATCACCATCGATATCGCTCTTTGGAAGTTCGAGACCCCCAAGTACTACGTCACCGTCATTGACGCTCCCGGTCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCTATCCTGATCATTGCTGCTGGTACGGGTGAGTTCGAG >UAMH11150_AY544615_LSU TGCGTGGTGTTGGGGCGTTCTGCGGCCAGGCCTGCGCCCAGTGCAGGCCGCCGCAGCCCCCGAAAGCCAGTGGCGGGCCGGCAGCGGGCTCCGAGCGCAGTAAGCATCACGCCCTCGCTCTGGACGCTCCCGCCTGCGCCCTGCCCCACAGACCGGCAGACGCGAGTCTGCCTCCTTCTCAAGGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAGATTTGGAATCTGGCCCCCAGGGCCCGAGTTGTAATCTGGAGAGGATGCTTCTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGGACGCCTAGCCTTTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCCCGTGGCCAGACTTGTGCCCCGCGGACCACCCGGCGCCCTTAGCGCCGGTGCACTCCGCGGGGCGCAGGCCAGCATCGGTTTTCCTAGGGGGATAAAGGCGGCGGGAA

IMAGES:

LOCATION: